Strategic Response to Climate Change by Global Companies Essay

Strategic Response to Climate Change by Global Companies - Essay Example It will clearly show what the future holds for these companies as well as their sustainability. The study will use qualitative and inducive methods of investigation to capture these characteristics. Apart from the operations managers in the three companies, information from the people in the UK is also going to be of great help. It also purposes to prove that the three companies invest considerable amount of resources on ecology, they have strategic climate change policies, and that they promote climate change awareness among employees as well as other stakeholders. It also aims to show how climate change affects the internal organization of the companies, and the business itself. It will also prove that the companies are working towards carbon dioxide emission reduction, by using various policies. It will also show how climate change affects the nature of their emerging products, and how they involve third parties in the climate change awareness. The study also seeks to propose stud ies in other industries and on stragies organizations in third world countries are employing in combating climate change. TÐ BLЕ OF CONTЕNTS ABSTRACT 1. CHAPTER 1 - INTRODUCTION 1.1 Outline of the study 1.2 Background of the research 1.3 Problem Statement 1.4 Rationale 1.5 Aims and Objectives 1.6 Significance 1.7 Research Questions 1.8 Research Methodology 1.9 Dissertation structure 2. CHAPTER 2 - LITERATURE REVIEW 2.1 Introduction 2.2 CorporÐ °tÐ µ RÐ µsponsÐ µs to ClÃ'â€"mÐ °tÐ µ ChÐ °ngÐ µ: ExÃ'â€"stÃ'â€"ng ClÐ °ssÃ'â€"fÃ'â€"cÐ °tÃ'â€"ons 2.3 EmÃ'â€"ssÃ'â€"on MÐ µÃ °surÐ µmÐ µnt Ð °nd TÐ °rgÐ µts 2.4 The Banking Sector 2.5 The Oil industry 2.6 Construction Companies and the Real Estate Sector 2.7 Automobile Industry 2.8... NÐ °turÐ µ Ð °nd clÃ'â€"mÐ °tÐ µ hÐ °vÐ µ Ð ° bÃ'â€"g rolÐ µ to plÐ °y Ã'â€"n thÐ µ Ð µxÃ'â€"stÐ µncÐ µ of mÐ °n kÃ'â€"nd. But wÃ'â€"th thÐ µ Ð °dvÐ µnt of Ã'â€"ndustrÃ'â€"Ð °lÃ'â€"sÐ °tÃ'â€"on, thÐ µ fÐ °tÐ µs of thÐ µsÐ µ forcÐ µs hÐ °vÐ µ chÐ °ngÐ µd. ThÐ µ Ã'â€"ndustrÃ'â€"Ð µs hÐ °vÐ µ usÐ µd nÐ °turÐ µ for thÐ µÃ'â€"r motÃ'â€"vÐ µ of profÃ'â€"t Ð °nd Ð µxploÃ'â€"tÐ µd Ã'â€"t wÃ'â€"thout Ð °ny concÐ µrn for Ð ° lÐ °rgÐ µ numbÐ µr of yÐ µÃ °rs. But thÐ µ tÃ'â€"mÐ µ hÐ °s chÐ °ngÐ µd Ð °nd thÐ µrÐ µ hÐ °vÐ µ bÐ µÃ µn cÃ'â€"rcumstÐ °ncÐ µs of nÐ °turÐ °l cÐ °lÐ °mÃ'â€"tÃ'â€"Ð µs Ð °nd Ð ° rÐ °pÃ'â€"d chÐ °ngÐ µ Ã'â€"n thÐ µ clÃ'â€"mÐ °tÃ'â€"c condÃ'â€"tÃ'â€"ons Ã'â€"n vÐ °rÃ'â€"ous rÐ µgÃ'â€"ons. It hÐ °s sÐ µnt thÐ µ compÐ °nÃ'â€"Ð µs on Ð ° bÐ °ck foot Ð °nd undÐ µr prÐ µssurÐ µ from vÐ °rÃ'â€"ous communÃ'â€"tÃ'â€"Ð µs Ð °nd Ã'â€"ntÐ µrÐ µst groups; thÐ µy no morÐ µ cÐ °n Ð µxploÃ'â€" t thÐ µ nÐ °turÐ µ Ð °t thÐ µÃ'â€"r wÃ'â€"ll Ã'â€"n ordÐ µr to sÐ °tÃ'â€"sfy thÐ µÃ'â€"r profÃ'â€"t motÃ'â€"vÐ µs. ThÐ µ compÐ °nÃ'â€"Ð µs of todÐ °y hÐ °vÐ µ bÐ µcomÐ µ much morÐ µ conscÃ'â€"ous Ã'â€"n thÐ µÃ'â€"r opÐ µrÐ °tÃ'â€"ons. (HoffmÐ °n, 1997, p.143)1.2 BÐ °ckground of thÐ µ rÐ µsÐ µÃ °rchOvÐ µr thÐ µ pÐ °st tÐ µn yÐ µÃ °rs, clÃ'â€"mÐ °tÐ µ chÐ °ngÐ µ hÐ °s mÐ °dÐ µ hÐ µÃ °dwÐ °y Ð °s Ð ° globÐ °l Ã'â€"ssuÐ µ, prÐ µmÃ'â€"Ð µr to thÐ µ Ð µmÐ µrgÐ µncÐ µ of nÐ µw Ã'â€"nstÃ'â€"tutÃ'â€"ons to hold bÐ °ck grÐ µÃ µnhousÐ µ gÐ °s (GHG) Ð µmÃ'â€"ssÃ'â€"ons. SÃ'â€"ncÐ µ thÐ µ Ð °doptÃ'â€"on of thÐ µ Kyoto Protocol Ã'â€"n 1997 Ð °nd thÐ µ lÐ °tÐ µr dÃ'â€"scussÃ'â€"ons on thÐ µ spÐ µcÃ'â€"fÃ'â€"cÃ'â€"tÃ'â€"Ð µs Ã'â€"n pÐ µrÃ'â€"ods of Ã'â€"mplÐ µmÐ µntÐ °tÃ'â€"on, Ð µspÐ µcÃ'â€"Ð °lly Ð µmÃ'â€"ssÃ'â€"ons dÐ µÃ °lÃ'â€"ng hÐ °s profÃ'â€"tÐ µd ground Ð °s Ð ° lÐ µgÃ'â€"tÃ'â€"mÐ °tÐ µ wÐ °y to dÐ µÃ  °l wÃ'â€"th thÃ'â€"s Ð µnvÃ'â€"ronmÐ µntÐ °l Ã'â€"ssuÐ µ. EmÃ'â€"ssÃ'â€"ons trÐ °dÃ'â€"ng Ð °llow countrÃ'â€"Ð µs whÃ'â€"ch drop undÐ µr thÐ µ Kyoto Protocol to dÐ µcrÐ µÃ °sÐ µ thÐ µÃ'â€"r GHG Ð µmÃ'â€"ssÃ'â€"ons by swÐ °ppÃ'â€"ng pÐ °rt of thÃ'â€"s rÐ µsponsÃ'â€"bÃ'â€"lÃ'â€"ty wÃ'â€"th Ð °nothÐ µr pÐ °rty to thÐ µ Protocol. HowÐ µvÐ µr, thÐ µ Ã'â€"mplÐ µmÐ µntÐ °tÃ'â€"on of thÃ'â€"s Ã'â€"ntÐ µrgovÐ µrnmÐ µntÐ °l Ð µmÃ'â€"ssÃ'â€"ons dÐ µÃ °lÃ'â€"ng rÐ µgÃ'â€"mÐ µ on Ð ° busÃ'â€"nÐ µss grÐ °dÐ µ hÐ °s glÃ'â€"mpsÐ µd lÐ °rgÐ µ dÃ'â€"vÐ µrsÃ'â€"ty worldwÃ'â€"dÐ µ

Liberalisation that Triggered the Asian Crisis and the Apparent Essay

Liberalisation that Triggered the Asian Crisis and the Apparent Insulation of China and India - Essay Example Least expected is that, in a very short period of time, a financial crisis sprouted in Thailand and spread like epidemic to the neighbouring countries of Southeast Asia and eventually triggered serious turmoil in the currency and financial markets of Japan and South Korea. While the extent of crisis differed from country to country, the Asian economies were brought face to face with serious difficulties that came from over-reliance on short-term foreign capital, speculative investments, and poor supervision by financial authorities. Even the resilient economies of Singapore, Taiwan, and Hong Kong have shown related problems, slowly being eroded by the persistent weaknesses of their neighbouring economies. What may have gone wrong that spelled the unfortunate events to take place? Why did some countries in the region, like China and India, have been unaffected by the crisis? What measures did these affected countries do to thwart the eventual downfall of their economies? What did policies did India and China foster in order to insulate them from the said crisis? As this paper explored answers to these questions, further recommendations by experts will also be tackled in order to prevent the same crisis from ever happening again. Liberalisation is termed as a programme of changes in the direction of moving towards a free-market economy. This normally includes the reduction of direct controls on both internal and international transactions, and a shift towards relying on the price mechanism to co-ordinate economic activities. In such a programme less use is made of licences, permits and price controls, and there is more reliance on prices to clear markets.

How Not Getting Enough Sleep Affects Your Body Essay Example for Free

How Not Getting Enough Sleep Affects Your Body Essay It is extremely important for people to understand how lack of rest affects the body so that they will be more aware of the effects of not getting enough sleep every night. A lack of sleep can cause loss of brain function, and even death if continued for a long period of time. The effects of a consistent lack of sleep can be very dangerous to the person and others around them. The longer the person goes without sleep, the worse the effects will be until the person passes out and becomes hospitalized or has a fatal accident. A lack of sleep affects different parts of the body in more than one way and in different degrees depending on how long the person has gone without sleep. The largest effects of lack of sleep on the body can be seen on the brain of the individual. Going without sleep for a 24 hour period can result in the person exhibiting behavior resembling drunkenness, with studies showing that people in this condition are more dangerous when driving than people that are legally drunk. People that are suffering from lack of sleep can experience memory lapses, decreased concentration, and hallucinations. As this continues, the person can experience depersonalization where they do not believe that they or any of the people around them are real, almost ass they feel they are living in a dream. Psychotic episodes may also appear in the person which may or may not disappear after the person has returned to a normal sleeping schedule. A lack of sleep does not only affect the brain, but affects money other areas throughout the body as well, People that have gone without proper amount of sleep for a long amount of time can experience muscle fatigue, a weakened immune system, blurred vision, headaches, and nausea. Other effects such as muscle tremors, color blindness, hyperactivity, and weight loss or gain may occur. Lack of sleep has been linked to many different health conditions including hypertension, diabetes, heart disease, and many different mental conditions. In most cases, returning to normal sleep each night can stop these conditions but in some cases, the damage is irreversible. There are many ways that a lack of sleep can affect the body and each of the consequences of not getting enough rest can be dangerous to the person health and well being. Washington

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

Home Theater :: Television Media Entertainment Technology Essays

Home Theater What is a home theater? There are three main components of a home theater system, which are a video display, a source, and sound systems. A basic home theater has a television (at least 27†), a good DVD player, and a surround sound system with at least 4 speakers. Today, we can benefit from recent breakthroughs in electronic such as progressive scan DVD players, flat panel TV and Dolby Digital surround sound. And also the packaged systems make assembling home theater easier than you can imagine. Video Display The video display is the most important component of your home theater. If the picture doesn't look good or isn't big enough, it will lower the impact of the movie considerably. The display is also probably the most expensive piece of a home theater, generally covering half of the total value of the system. There are so many types of displays but the ones to look at are traditional tube TVs for the lower end systems, rear projection TVs for mid range systems and front projection systems for high end system. There are several things you need to look to buy a TV: 1. Fit in the room Screen size is the most important factor in choosing a TV because you'll still want the most immense pictures you can get, which generally means you want to sit 1.5 times the screen's diagonal measurement away from a wide-screen HDTV. For example, a 42-inch HDTV should be placed at least 63 inches from the couch. You need to consider viewing distance too in order to get full performance of your television. 2.Size and display type Most sets up to 40 inches diagonally are direct view, meaning they use the common glass to display the image. Direct-view TVs remain the most popular thanks to their smaller sizes but also because they generally provide a brighter picture with a wider viewing angle than larger rear-projection TVs. The main advantage of a rear-projection set is size because they range between 40 and 82 inches diagonally. 3. Choosing Aspect Ratio If you watch mostly television, like news and sports, you are better off with conventional 4:3 aspect ratio, but if you watch mostly movies, you are better off with wide screen 16:9 aspect ratio. But, it always depends on what you watch and what you need the most. Wide-screen sets also let you stretch the image horizontally to eliminate the window-box bars or otherwise broaden or crop the picture to fill the wide screen.

Hittite’s Self-Image Characterized by Grandeur :: Hittite Culture Cultural History Essays

Hittite’s Self-Image Characterized by Grandeur The Hittite empire, like many others of the Bronze Age, arose at a time when new tactics and implements for fighting were being developed in abundance. Like many other empires of that time, the Hittites recognized the importance of protecting their lands and acquiring new ones. As the size and influence of the Hittite empire grew, it sometimes formed peaceful agreements with foreign lands. These agreements, however, primarily served their own interests. Evidence of the behavior of the Hittites found in primary documents reveals that they treated civilizations other than their own as their inferiors. Religion was central to the Hittite’s culture and they considered their devotion to it to be one of their primary strengths. The upkeep of Hittite religious institutions and their functionaries was a primary obligation of the commander of the Hittite border guards. A document containing instructions for that commander explains these responsibilities: â€Å"In the town through which the commander [passes]†¦ he shall attend to the necessary provisions for town-elders, priests, ‘anointed’ (and) mothers-of-god.† (par. 1) It was important to the Hittite king (also called the Sun) that all cities in the empire contain adequate sites for worship of the Hittite gods. This suggests that they believed paying tribute to the gods ensured them some sort of security or protection. In that same document it was stated, â€Å"The commander of the border guards shall make an inventory of the god’s utensils and send it before the Sun.† (par. 3) ‘Utensils’ probably refers to the possessions of the gods, perhaps including their temples, servants, and any commodities held in their name. A list of them was most likely held by the king so that what the Hittites had given to their gods was on record. The magnitude of religion in this civilization and the closeness of it to the military reveal that the favor of and protection from its gods gave its people a perceived power and authority that other civilizations lacked. Religion was also directly connected to imperial Hittite rule through the king. In a treaty between Mursilis, Sun of the Hittites, and Duppi-Tessub, king of Amurru, the preamble mentions that Mursilis was the â€Å"favorite of the Storm-god.

Life or death †whose decision is it anyway?

The courses of actions that were taken shall be justified through the use of Immanuel Kant’s categorical imperative. The categorical imperative provides that one ought to, â€Å"[a]ct only on that maxim through which you can at the same time will that it should become a universal law.† There are however two formulations of the categorical imperative. The above-mentioned is the first one and the second is â€Å"[a]ct in such a way that you always treat humanity, whether in your own person or in the person of any another, never simply as a means but always at the same time as an end.†Scenario 1The primary issue at hand is whether or not it was ethical for the doctors in George Washington Hospital to insist that her baby be allowed to live despite Angela’s, her physicians’ and her family’s objections; especially when it was found that in the end, the surgery was a contributing cause to Angela’s death. Thus, the primary issue here is wheth er or not abortion would have been ethical given the situation. What is the best course of action to take given the situation?But even before proceeding, what exactly is the situation? The situation is the fact that Angela is faced with cancer and she has only a few days to live. Her physicians and her family wanted to preserve her life as much as they could. In addition, the surgery (cesarean section), which while gives the baby 50 to 60% chance to survive, endangers Angela’s life and withers the last few days that she has left, not to mention the fact that .   Furthermore, they estimated that there was a less than 20 percent chance that the child would be disabled.   The physicians also testified that the surgery would increase the chances of Angela Carter’s death.The best course of action taken was the course taken by the doctors in George Washington Hospital to insist that her baby be allowed to live despite Angela’s, her physicians’ and her famil y’s objections.. Thus, given the situation it would not have been ethical to abort the baby. This decision can be justified using Immanuel Kant’s categorical imperative.The categorical imperative can be explained simply through the discussion on duties. Basically if a course of action or decision is one’s duty, then it can be willed to become a universal law. If on the other hand, a course of action is not part of one’s duty then it cannot be said to become a universal law.Given the situation above, it is the duty of Angela’s doctors to uphold the value of life. In fact as doctors, it is part of their Hippocratic Oath â€Å"[t]o practice and prescribe to the best of my ability for the good of my patients, and to try to avoid harming them† and â€Å"[n]ever to do deliberate harm to anyone for anyone else’s interest.† However, it becomes complicated as they, in a way have to choose between Angela’s and her baby’s li fe. As it is their duty to protect their patients’ lives, they are now confronted with a scenario that they have to inevitably choose one of their patients’ lives. Thus, the question is can the doctors continue performing their duties without aborting the baby? Are there alternatives?Subjected to the first formulation of the categorical imperative, the action not to abort and keep the child may be regarded as a universal law and may be imposed upon any other individual who finds himself/ herself in such a situation.They may do without abortion as the same is in compliance with their duty to preserve life because there are other means by which they may still comply with their duty to Angela to protect and safeguard her life. One of these is by making sure that she is given the best possible attention during the surgery. It must be noted that Angela’s is bound to live for only a few days, no matter what the doctors do.The course of action is further affirmed and c larified as it is subjected to the second formulation. From such maxim arises the duty that human life must be protected and safeguarded because it must not be treated just as a means but always at the same time as an end.Ideally, the best course of action is to try all means possible and necessary to safeguard both Angela and her baby’s life. However, it must be noted that Angela’s life is already on the losing end and no matter what the doctors do, she was bound to die sooner rather than later. Thus, aborting the baby is but a means to making sure that Angela will live albeit for a few a days; with this fact, such course of action does not pass the second formulation of the categorical imperative. The life of the baby must be treated not just as a means but also as an end.Thus, in this case the doctors of George Washington Hospital undertook to perform the best course of action given the situation as at the end of the day, life or death is not a decision that any per son can make. For that matter, no one person can ever make that decision for someone else.Scenario 4The primary issue in this scenario was whether or not it would be ethical for the Dr. Wendy Smith to inform Jack’s father that he will die unless he gets a liver transplant.The issue arises from the fact that Jack believes that his father’s situation will worsen once the gravity of his predicament is made known to him. On the other hand, Dr. Wendy Smith believes by his sworn duty to inform the patient of what he is up against.In this situation there is a clash of duties between the duty of Jack to his father, as a son and the duty of the doctor to Jack’s father as his doctor. It is the duty of Jack to do everything in his power to make sure that the best interests of his father is upheld and taken care of. On the other hand, in addition to the above-mentioned duties of a doctor â€Å"[t]o practice and prescribe to the best of my ability for the good of my patient s, and to try to avoid harming them† and â€Å"[n]ever to do deliberate harm to anyone for anyone else’s interest,† it is also their duty â€Å"[t]o keep the good of the patient as the highest priority.†We shall now find out the resolve of the conflicting duties by subjecting them to the two formulations of the categorical imperative.With respect to Jack’s duty, it is true that the upholding the best interests of one’s parent can be willed that it should become a universal law. In addition, by upholding the best interests of one’s parent, one acts in such a way that he/she treats humanity, whether in your own person or in the person of any another, never simply as a means but always at the same time as an end.With respect to Dr. Wendy Smith’s duties â€Å"[t]o practice and prescribe to the best of my ability for the good of my patients, and to try to avoid harming them,† â€Å"[n]ever to do deliberate harm to anyone for anyone else’s interest,† and â€Å"[t]o keep the good of the patient as the highest priority.† The same can be willed that they can become universal laws and the same are also means by which humanity is treated not just as a means but also as an end.Thus, as both were subjected to the categorical imperative and both passed the formulations, what then? It can be noted that Jack’s duty is to make sure that the best interests of his father are upheld, but how does Jack know what his best interests are? Is concealing the truth to him of his best interest? Thus, we subject this to the categorical imperative.Concealing the truth cannot be willed to become a universal law. If the same were to be allowed to become universal law then all concealments of truth in all situations not related to the situation at hand will be justified. The same is inconsistent to upholding the virtue of truth. At the same time, concealing the truth is actually a method by which one is treated as a means and not as end. This is so as concealment provides a myopic view – it is a mere means for the people around Jack’s father to avoid the issue of his impending demise for themselves rather than making sure that Jack’s father is apprised of his situation and is prepared for the worst possible ending of his situation.Thus, the best course of action to take is the action backed up by Dr. Wendy Smith’s duty as a doctor to inform the patient of his predicament no matter how grave said situation is.